Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003.

By contrast, milling and drilling of composites can generally be done with a much lighter-duty machine, but high-end cutting tools as well as custom-built work ...

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

Dec 16, 2014 — Last night I was drilling a 1/2 hole and used my Ryobi drill. Drilled the hole and went to take out the bit....can't loosen the chuck.

The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid.  Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Copper-nickel is often used in heat exchangers because it has a higher heat conductivity than other metals. It can transfer heat more efficiently, making it ideal for applications requiring quick and efficient movement. Whether you’re using a car radiator or a home heating system, there’s a good chance that it contains copper-nickel to help transfer heat.

PVD coating means Physical Vapor Deposition of Titanium, Titanium Aluminium and Chromium. The process is also referred to as Titanium / Titanium Aluminium / ...

To download a certificate of analysis for Penicillium venetum (Frisvad) Frisvad (16025), enter the lot number exactly as it appears on your product label or packing slip.

Invitrogen Anti-ETV4 Polyclonal, Catalog # PA5-76825. Tested in Western Blot (WB), Immunocytochemistry (ICC/IF) and Immunohistochemistry (IHC) applications.

Find wholesale turning tool according to many applications. Take advantage of the special deals we offer to buy your tungaloy carbide turning inserts at a ...

Harvey Chip Rice, Counselor, Greensboro, NC, 27406, (336) 948-8467, Life is full of challenges. We ALL face challenges throughout the course of life with ...

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

One of the most common uses of copper-nickel is in currency coins. The US penny, for example, is 97.5% zinc and 2.5% copper. Cupronickel is often used in coinage because it resists wear and tear better than pure metals like copper or silver. In addition, cupronickel alloys are less likely to corrode than other alloys, such as brass.

Seifert KA, Louis-Seize G. Phylogeny and species concepts in the Penicillium aurantiogriseum complex as inferred from partial beta-tubulin gene DNA sequences. In: Integration of modern taxonomic methods for Penicillium and Aspergillus classification (Samson RA, Pitt JI, eds.), pp. 189-198, Taylor and Francis Books Ltd., UK, 2000.

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

If a requested product is not a hazardous chemical, or does not contain any hazardous chemicals, a SDS is not required and therefore will not be provided.

ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions)

You can check the status of your application in your My Dashboard portal. You can select the "Continue Account Application" button below if you need to complete your application.

Top and perspective views of a graphic representation of the periodic table of chemical elements depicted as a helix drawn on a single cylinder. This table ...

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA

Cupronickel is frequently used in desalination plants because it can withstand the high temperatures and pressures associated with desalination. Additionally, cupronickel doesn’t corrode when exposed to salt water, which makes it ideal for marine applications. The process works by heating water to create steam, which you then can use to drive a turbine that powers the desalination process.

Wieland Diversified is the best place to purchase high-quality copper-nickel bars. We offer a variety of sizes and shapes to meet your needs, and our team is always happy to answer any questions you may have. Contact us today to learn more!

Cupronickel is a popular choice for marine hardware such as boat propellers and hulls because it resists saltwater corrosion better than other metals. Additionally, cupronickel doesn’t lose its strength when exposed to salt water, which makes it ideal for this application. Not only does cupronickel resist corrosion, but it’s also stronger than other metals, making it suitable for use in boat propellers.

TATCCCCTCCAGACGCGTCTTTTGTTTTCACACGGCCCCTGAGCCATGACCCCACTCTCAACAGATCTTTTGCTAACATGATCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCGATATGGAATATTCTTGGAAACATTCTTCGATTCGTGGGACTAAATTGGAATTGGCTTGCAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTGCCGAGCTTTTTTTTTTTCGCGTTGGGTATCAATTGACAGGTTACTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGCCTCGATGGTGATGGACAGTAAGTTTTAATGGTGATGAGGGTTTCCGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTCCAACGACTGGAAAACGAATAATCGTGCATCATCTGATCGGATGTTTTCTTTGATAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGG

Versatile corner rounder machine for signage and wide format digital print. With aluminum composite panels and polypropylene cutting scope & eyelet press.

As part of the Wieland Group since 2018, Wieland Diversified will be able to continue to provide its customers with the quality and service they have come to expect. Learn more at Wieland.com

The certificate of origin for that lot of Penicillium venetum (Frisvad) Frisvad (16025) is not currently available online. Complete this form to request this certificate of origin.

Copper-nickel, also known as cupronickel, is an alloy made of copper and nickel. It’s known for its corrosion resistance, making it a popular choice for various applications.

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTCACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

The certificate of analysis for that lot of Penicillium venetum (Frisvad) Frisvad (16025) is not currently available online. Complete this form to request this certificate of analysis.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003.

You might be surprised to learn that copper-nickel works best in various everyday items. These are five everyday uses of copper-nickel that you didn’t know.

You can also start a new application by selecting the "Start a new account application" below to establish another account with ATCC.

This product sheet is not available online. We only provide this product sheet to customers who have purchased this biosafety level 3 product. If you purchased this product, please contact the distributor from whom you purchased this product for this product sheet.

TATTTGTGAGTGACTCTACATACAAATCGAAGACGTGAAGGTCGAACATGCTGACCGAGAGTTTGTTTTGTTGCGGAATAGGACAAGGATGGCGATGGTACGTGTGGTCGCGCCCGACAGCTCAGTTGAGCCCACAGCAGTGTCCTCTGTGGTCGAATTTCAAGAGAAAAGTCTCCTAACACACAATTCTCCCAATAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCTGAGTTGCAGGATATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCTGGTACTTGACCATAACCCACTGATATAAACGAGAGACGGCTATTGACGTGCGATAGAATTCCTCA

Copper-nickel piping is commonly used in marine environments because it resists saltwater corrosion better than other piping materials. It also works in high-pressure steam lines and hydraulic systems. When you see greenish-brown stains on pipes, that’s cupronickel!

Nov 23, 2019 — Simples ! 10-15 deg on everything except with a tool for brass or bronze as I don't touch the top of the cutting tool so no side or back rake.

A copper-nickel bar is a versatile metal with various uses thanks to its resistance to corrosion. You can find it in currency coins, piping, desalination plants, heat exchangers, and marine hardware. Next time you see a penny or a boat propeller, think about the role copper-nickel plays in our everyday lives!

AAAGAAGCGACTCGATTTGGCTGGTCCGCTTTTGGCAAGTCTTTTCCGGACTCTTTTCACCCGAGTCACAAAGGATCTTCAGCGTTATGTGCAGCGATGCGTTGAGACCAATCGCGAAATTTATCTCAACATTGGTATCAAGGCTAGCACATTGACCGGTGGATTGAAGTATGCTCTTGCTACTGGTAACTGGGGCGAGCAGAAGAAGGCGGCTTCTGCCAAGGCTGGTGTATCCCAGGTGCTGAGTCGTTACACATTCGCTTCCTCCTTGTCTCACTTGCGCCGAACCAACACACCCATTGGCAGAGATGGAAAGATTGCCAAACCCCGCCAACTCCATAATACCCATTGGGGCCTGGTCTGTCCGGCCGAGACACCCGAAGGTCAAGCTTGTGGTTTGGTCAAGAACCTGGCACTGATGTGTTACATCACCGTTGGCACACCCGCCGAGCCCATCGTGGACTTCATGATTCAACGCAACATGGAAGTCCTCGAGGAGTTTGAACCGCAAGTGACGCCCAACGCGACAAAGGTGTTCGTTAATGGTGTCTGGGTGGGTATTCACCGGGACCCTTCGCACCTTGTTACTACGATGCAGAATCTGCGTCGACGAAACATGATCTCCCACGAAGTCAGTTTGATTCGTGACATTCGTGAACGGGAGTTCAAAATCTTCACCGATACTGGACGTGTCTGCCGGCCACTGTTCGTTATCGATAACGACCCCAAGAGTGAGAACTCGGGTGGATTGGTCCTTAACAAGGACCACATTCGGAAGCTCGAGTCCGACAAAGACTTGCCAACAGACTTGGGCCCAGAAGAACGCCGTGAACAATACTTCGGATGGGATGGTCTGGTGCGCTCTGGAGCAGTTGAGTATGTCGACGCCGAAGAGGAGGAAACCATCATGATTGTCATGACCCCCGAGGACCTCGAGATCTCTCGCCAGCTTCAGGCTGGTTACGCTCTGCCAGAAGACGAAACCAGCGATCCCAACAAGCGTGTTCGGTCGATTCTCAGCCAGCGTGCCCACACCTGGACGCACTGCGAAATTCATCCTAGTATGATCTTGGGTGTTTGCGCCAGTATTATTCCTTTCCCGGATCACAACCAGTCGCCGCGTAACACCTATCAGTCTG

To download a certificate of origin for Penicillium venetum (Frisvad) Frisvad (16025), enter the lot number exactly as it appears on your product label or packing slip.

Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM.

HELIQUARD-Series IC328 Grade TiN/TiCN/TiN coated Carbide SPMT-Style Milling Insert, Square Shaped. MI ITEM #04680654. MFR #5603693. In Stock. In stock.

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.