ZIP Code 73070 Cleveland, Norman, OK - 73070 zip code
The certificate of origin for that lot of Penicillium venetum (Frisvad) Frisvad (16025) is not currently available online. Complete this form to request this certificate of origin.
The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.
To download a certificate of origin for Penicillium venetum (Frisvad) Frisvad (16025), enter the lot number exactly as it appears on your product label or packing slip.
This product sheet is not available online. We only provide this product sheet to customers who have purchased this biosafety level 3 product. If you purchased this product, please contact the distributor from whom you purchased this product for this product sheet.
The certificate of analysis for that lot of Penicillium venetum (Frisvad) Frisvad (16025) is not currently available online. Complete this form to request this certificate of analysis.
To download a certificate of analysis for Penicillium venetum (Frisvad) Frisvad (16025), enter the lot number exactly as it appears on your product label or packing slip.
YP - The Real Yellow PagesSM - helps you find the right local businesses to meet your specific needs. Search results are sorted by a combination of factors to give you a set of choices in response to your search criteria. These factors are similar to those you might use to determine which business to select from a local Yellow Pages directory, including proximity to where you are searching, expertise in the specific services or products you need, and comprehensive business information to help evaluate a business's suitability for you. “Preferred” listings, or those with featured website buttons, indicate YP advertisers who directly provide information about their businesses to help consumers make more informed buying decisions. YP advertisers receive higher placement in the default ordering of search results and may appear in sponsored listings on the top, side, or bottom of the search results page.
ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions)
TATTTGTGAGTGACTCTACATACAAATCGAAGACGTGAAGGTCGAACATGCTGACCGAGAGTTTGTTTTGTTGCGGAATAGGACAAGGATGGCGATGGTACGTGTGGTCGCGCCCGACAGCTCAGTTGAGCCCACAGCAGTGTCCTCTGTGGTCGAATTTCAAGAGAAAAGTCTCCTAACACACAATTCTCCCAATAGGACAAATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCGCTGGGCCAGAACCCCTCCGAGTCTGAGTTGCAGGATATGATCAACGAGGTTGACGCCGACAACAACGGCACCATTGACTTCCCTGGTACTTGACCATAACCCACTGATATAAACGAGAGACGGCTATTGACGTGCGATAGAATTCCTCA
Seifert KA, Louis-Seize G. Phylogeny and species concepts in the Penicillium aurantiogriseum complex as inferred from partial beta-tubulin gene DNA sequences. In: Integration of modern taxonomic methods for Penicillium and Aspergillus classification (Samson RA, Pitt JI, eds.), pp. 189-198, Taylor and Francis Books Ltd., UK, 2000.
While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.
From Business: Located in Cranston, R.I., Advantage Glass Company is one of the leading professional glazing companies in the industry. The firm's area of specialization…
From Business: Improve Your Retail Experience by Shopping at Our Online Mall Do you hate fighting crowds at brick-and-mortar retail stores? Never leave your home for the things…
AAAGAAGCGACTCGATTTGGCTGGTCCGCTTTTGGCAAGTCTTTTCCGGACTCTTTTCACCCGAGTCACAAAGGATCTTCAGCGTTATGTGCAGCGATGCGTTGAGACCAATCGCGAAATTTATCTCAACATTGGTATCAAGGCTAGCACATTGACCGGTGGATTGAAGTATGCTCTTGCTACTGGTAACTGGGGCGAGCAGAAGAAGGCGGCTTCTGCCAAGGCTGGTGTATCCCAGGTGCTGAGTCGTTACACATTCGCTTCCTCCTTGTCTCACTTGCGCCGAACCAACACACCCATTGGCAGAGATGGAAAGATTGCCAAACCCCGCCAACTCCATAATACCCATTGGGGCCTGGTCTGTCCGGCCGAGACACCCGAAGGTCAAGCTTGTGGTTTGGTCAAGAACCTGGCACTGATGTGTTACATCACCGTTGGCACACCCGCCGAGCCCATCGTGGACTTCATGATTCAACGCAACATGGAAGTCCTCGAGGAGTTTGAACCGCAAGTGACGCCCAACGCGACAAAGGTGTTCGTTAATGGTGTCTGGGTGGGTATTCACCGGGACCCTTCGCACCTTGTTACTACGATGCAGAATCTGCGTCGACGAAACATGATCTCCCACGAAGTCAGTTTGATTCGTGACATTCGTGAACGGGAGTTCAAAATCTTCACCGATACTGGACGTGTCTGCCGGCCACTGTTCGTTATCGATAACGACCCCAAGAGTGAGAACTCGGGTGGATTGGTCCTTAACAAGGACCACATTCGGAAGCTCGAGTCCGACAAAGACTTGCCAACAGACTTGGGCCCAGAAGAACGCCGTGAACAATACTTCGGATGGGATGGTCTGGTGCGCTCTGGAGCAGTTGAGTATGTCGACGCCGAAGAGGAGGAAACCATCATGATTGTCATGACCCCCGAGGACCTCGAGATCTCTCGCCAGCTTCAGGCTGGTTACGCTCTGCCAGAAGACGAAACCAGCGATCCCAACAAGCGTGTTCGGTCGATTCTCAGCCAGCGTGCCCACACCTGGACGCACTGCGAAATTCATCCTAGTATGATCTTGGGTGTTTGCGCCAGTATTATTCCTTTCCCGGATCACAACCAGTCGCCGCGTAACACCTATCAGTCTG
From Business: Our goal is to satisfy our customers 110% so they will tell others. Over 85% of our business are recurring and referred customers. We are countertop specialists.…
From Business: To get to our Lincoln location take Albion Rd. to Powder Hill Road which leads to Wellington Road. Our 80,000 square foot warehouse and large showroom offer the…
From Business: Our West Bridgewater warehouse and showroom are conveniently located 1mile off Rte. 24 exit 17 to Rte. 123. West Bridgewater leading distributor in Certainteed…
GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTCACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
From Business: If you need a general contractor in Providence, Rhode Island or surrounding areas, count on the experts at Arnel Sales Company to get the job done right. Having…
You can check the status of your application in your My Dashboard portal. You can select the "Continue Account Application" button below if you need to complete your application.
From Business: We are located off Metro Center Blvd. in Warwick, RI in the Industrial complex. Drive past FedEx and we are the next road on the right-hand side! Offering vinyl…
From Business: Our Southborough branch is conveniently located right off RT 30 and RT9 in Southborough, Massachusetts. We proudly distribute a full product line of roofing…
Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.
ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.
Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003.
From Business: The Smithfield Home Depot isn't just a hardware store. We provide tools, appliances, outdoor furniture, building materials to Smithfield, RI residents. Let us…
From Business: Cambio Plywood is a wholesale distributor of building materials for cabinets and countertops. Our customer base consists of woodworking shops, contractors and…
It is over 4 years now and our new windows and siding are holding up very well. Now that John DiMauro and crew do roofs, I will remember them when I need my roof done. Their…
ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.
TATCCCCTCCAGACGCGTCTTTTGTTTTCACACGGCCCCTGAGCCATGACCCCACTCTCAACAGATCTTTTGCTAACATGATCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCGATATGGAATATTCTTGGAAACATTCTTCGATTCGTGGGACTAAATTGGAATTGGCTTGCAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTGCCGAGCTTTTTTTTTTTCGCGTTGGGTATCAATTGACAGGTTACTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGCCTCGATGGTGATGGACAGTAAGTTTTAATGGTGATGAGGGTTTCCGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTCCAACGACTGGAAAACGAATAATCGTGCATCATCTGATCGGATGTTTTCTTTGATAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGG
From Business: Since 1959, our team has been serving Rhode Island, Massachusetts, and Connecticut. Our products meet all Rhode Island D.O.T. standards and exceeds the A.S.T.M.…
I had 2 units of glass on my sliding door replaced today. Just a great job. And my screens can slide again!! The glass installed looks like it was not even replaced. Thank…
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA
If a requested product is not a hazardous chemical, or does not contain any hazardous chemicals, a SDS is not required and therefore will not be provided.
You can also start a new application by selecting the "Start a new account application" below to establish another account with ATCC.
Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM.
This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.
Great company! Got 3 different quotes for a liner job and a-Tecs was the most fair, the guys showed up exactly as scheduled, cleaned up after themselves (spotless!) and…
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.
Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003.
ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.